Lab 2
CSci 127: Introduction to Computer Science
Hunter College, City University of New York
Summer 2020

This week's lab will introduce strings and lists in Python and some simple Unix commands.

Software tools needed: web browser and Python IDLE programming environment.

Quizzes

See the quiz page for details of the work due this week.

Using Python, Gradescope, and Blackboard

See Lab 1 for details on using Python, Gradescope, and Blackboard.

Strings

A sequence of characters (i.e. letters, numbers, symbols) is called a string. To indicate a string, we use quotes (either single or double, just as long as they match up) to indicate the start and end (a fancier way to say that is: quotes deliminate the string). For example, for our first program, we wrote:

print("Hello, World!")

The string, or sequence of characters, Hello, World!, was printed to the screen. We can also store strings to be used again in the program. For example,

greeting = "Hello, World!"
print(greeting)

creates a location in memory that can be accessed by typing the name (or identifier) that we chose: greeting. greeting stores the string Hello, World!. While the quotes are not stored, we will often write "Hello, World!" to make it more clear where the string begins and ends. When we execute the code above, it will create the variable, greeting, and then print out the message:

Hello, World!

We can use the variable any number of times. For example, if we wanted to print the message twice, we could use:

greeting = "Hello, World!"
print(greeting)
print(greeting)

More Useful String Methods

Since strings are used everywhere, there are many built-in functions for strings.

• Guess which each does from its name, then
• Click the forward button in the code window below to see if you guess was correct.

For historic reasons, we start counting at 0, instead of 1, in many computer languages, including Python. When you use find() command on the string ``Hello, World!'', the first character is at 0, the next character at 1, etc.

0	1	2	3	4	5	6	7	8	9	10	11	12
H	e	l	l	o	,		W	o	r	l	d	!

The find() command gives the location of "ll" which is 2 if you start by counting the first character as 0.

Getting Input

Last week, we used the print() function to write messages to the user of our program. This week, we introduce, input(), to get information from the user. Here's the basic format:

aString = input("Put a message here to show user: ")

where the string "Put a message..." is replaced by the prompt you would like the user to see and aString with the name of the string you are using in your program.

Let's write a program that combines the asking the user for input with the string commands a the beginning of the lab. The program will:

1. Prompt the user for a message and store it in the variable, mess.
2. Print the message to the screen.
3. Print the message in all capital letters.
4. Print the message in all lower case letters.

To start, open IDLE and start a new file window. Put a comment (lines that begin with '#') that includes your name and a short description of what the program does.

1. Next, fill in the code that prompt the user for a message and store it in the variable, mess (see the example above).
2. Print the message to the screen (also done in the example above).
3. To print in all capital letters, you can use the upper() command (see first example in the lab).
4. Print the message in all lower case in a similar way.

Save your file as you go, and then run it. Try different messages to make sure it works with different inputs. When it works, see the Programming Problem List.

Looping Through Strings

You can also loop through strings. Try running the code below:

Each character has a number assigned to it. When you write a character, it is converted to its number, and that is stored instead to save space. Python uses the standard Unicode encoding (which extends the popular ASCII encoding to new symbols and alphabets). For example, ord('a') give the Unicode number for the character, a, which is 97.

Let's look at the Unicode of the characters in our string:

Modify the program to:

• To prompt the user to enter a string and store it in myString, and
• Only print the ASCII code of each character (instead of the character and its ASCII code)

When it works, add in your name in a comment, and see the Programming Problem List.

To go the other direction, there's a function chr() which takes numbers and returns the corresponding character. For example, chr(97) returns 'a'. Let's look at the characters with unicode from 65 to 69:

The range() statement has several different options:

• range(stop): if you have only a single number in the parenthesis, it will generate all the numbers from 0 to stop-1. For example, range(5) generates the numbers 0, 1, 2, 3, 4.
• range(start, stop): if you have only two numbers in the parenthesis, it will generate all the numbers from start to stop-1. For example, range(65,70) generates the numbers 65, 66, 67, 68, 690 .
• range(start, stop, step): if you have three numbers in the parenthesis, it will generate all the numbers from start to stop-1, increasing by step each time. For example, range(100,200,10) generates the numbers 100, 110, 120, 130, 140, 150, 160, 170, 180, 190.

Looping Through Lists

You can loop through a list the same way as you loop through a string.

The split() function breaks up a string into substrings, throwing away the character or delimiter on which the function splits.

Then you can loop through the list just like you loop through a string to access the individual substrings.

For example, given the string "FridaysSaturdaysSundays", split('s') will break up the string into a list of days: ["Friday","Saturday","Sunday",""] throwing away the 's' characters on which it splits.

Notice that it will produce an empty string at the end because of the 's' character at the end of "Sundays".

Try running the code below:

Modify the code to remove the 's' at the end of 'Sundays', now run and inspect the list. What changed?

Biomolecular Sequences

Let's apply what we just learned to some questions from biology. DNA is a molecule that contains instructions for the cell (wiki). We can represent it as a string of four characters: 'A', 'C', 'G', and 'T' corresponding to the four nucleotides that are the building blocks for the sequences. For example,

insulin = "AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGTGGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGC"

is the start of the DNA sequence for insulin in humans.

We have the tools to compute how long the out sequence is as well as GC-content (the fraction of the sequence that is C and G) which is correlated with the stability of the molecule:

• First, we compute the length of the sequence.
• Next, we count the number of 'C' and number of 'G'.
• Next, we add the number of 'C' and number of 'G' together, and divide by the length.
• Then, we convert to a percentage by multiplying by 100 and print out the answer.

Looping Through Strings, Revisited

There's another way we can loop through strings, using the index of each character. Let's assume that we have:

greeting = "Hello, World!"

Before, we printed out the whole string with:

print(greeting)

If we wanted to print out only the first letter, we could write:

print(greeting[0])

where the number between the square brackets is the index of the character, in this case, 0, or the very first character of the string.

Try guessing what the following code does and then running it:

Files & the Command Line Interface

The terminal is a program that allows users to type commands (separate from Python) that we can use to communicate with the operating system. It's often called the command line interface or shell. It predates the graphical interface that is now available and is incredibly useful for automating tasks and working on remote servers. We will slowly introduce shell commands over the course of the semester and eventually incorporate them into some programming assignments.

We have already used the shell in the previous lab. When you typed:

$  idle

you were asking the operating system to launch the program idle3. The laptop was configured to first look in folders containing applications, and then to check your home folder, and then to check the current folder you are using to find an application by that name.

Let's create a new directory, or folder, to hold your images (using the shell or command line). Where it says thomasH below, replace with your name. It is easier if you avoid spaces in the names:

• Open a new terminal window (go to the upper left menu icon, search for terminal and click, or if you already have terminal, you can click on its menu to create a new window).
• In the terminal window, type:

  $ pwd

  (The $ represents the prompt at the command line-- no need to type it.)

  This tell you the path, or location, of your current working directory. To see what is in the folder, you request a 'listing':

  $ ls

• To add a new directory, we type:

  $ mkdir thomasH

  (replace thomasH with your name to create a directory for you!).

  Now, when we list the current directory, we should new item (namely the directory with your name):

  $ ls

• Let's change directories:

  $ cd thomasH

  If we ask for a listing (ls), we will now see the contents of your directory.

The graphical interface and shell are operating on the same underlying system, so, changes you make with one can be seen by the other. If you open up the file icon (on left hand menu bar) and click the Home directory, you will see the folder you just created.

In the next lab, we will explain how to copy and move files between directories.

What's Next?

If you finish the lab early, now is a great time to get a head start on the programming problems. There's instructors to help you, and you already have Python up and running. The Programming Problem List has problem descriptions and suggested readings.